Fam114a1 gene
WebUpdates to this gene will be send to {{ username }} {{geneWatchAttr}} ... Orthologous to human FAM114A1 (family with sequence similarity 114 member A1); INTERACTS WITH … WebFeb 21, 2024 · In this study, w e found a novel gene FAM114A1 that plays an important role in pathological cardiac . remodeling and fibrosis. FAM114A1 is induced in human failing hearts as well as in HF mouse .
Fam114a1 gene
Did you know?
Webfam114a1 ID ZDB-GENE-070410-52 Name family with sequence similarity 114 member A1 Symbol fam114a1 Nomenclature History Previous Names. zgc:162266; Type protein_coding_gene Location Chr: 1 Mapping Details/Browsers Description Orthologous to human FAM114A1 (family with sequence similarity 114 member A1). ... WebMutation details: This allele from project Fam114a1-7878J-M7854 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAAGCAACCACATCTCCC, AGATGTGGTTGCTTGGTGGT, TTTGACATAGCGTACATTGA and ATGGAGTTTAACGTTTGCTC, which resulted in a …
WebFAM114A1. gene product. Noxp20. The protein encoded by this gene belongs to the FAM114 family and may play a role in neuronal cell development. Alternative splicing … WebOfficial gene symbol, which is typically a short form of the gene name, according to HGNC. FAM114A1 (Noxp20) Protein classi. Assigned HPA protein class (es) for the encoded protein (s). Read more. Number of transcriptsi. Number of protein-coding transcripts from the gene as defined by Ensembl. 3.
WebJun 19, 2024 · The gene sets were defined as all the putative target genes that share the same ontology described in the Gene Ontology (GO) database (Harris et al., 2004). ... we observed genes involved in CNS formation, including brain and eye development, such as CSPG5, DOCK7, FAM114A1, KAT6B, MELK, NEUROD1, NLGN1, PAX3, PAX6, … WebFAM114A1. GENERAL INFORMATIONi. General description of the gene and the encoded protein (s) using information from HGNC and Ensembl, as well as predictions made by the Human Protein Atlas project. Gene namei. Official gene symbol, which is typically a short form of the gene name, according to HGNC . FAM114A1.
WebApr 1, 2024 · FAM114A1: 4 disease terms (MeSH) has been reported with FAM114A1 gene. [Click : to re-sort the table] Disease Term (MeSH) Total Publication. Meta-analysis Publications Cardiovascular Diseases 2: 0 Diabetes Mellitus, Type 2 1: 0 Edema 1: 0 ...
WebExpression of FAM114A1 (Noxp20) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers. ... FAM114A1: Gene description i. Family with sequence similarity 114 member A1: Predicted location i … cristina rodríguez instagramWebGene symbol: FAM114A1: Gene ID (NCBI) 92689: Conjugate: Unconjugated: Form: Liquid: Purification Method: Antigen affinity purification: Storage Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. Storage Conditions: Store at … اسم غلا معناه شنوWebfam114a1 ID ZDB-GENE-070410-52 Name family with sequence similarity 114 member A1 Symbol fam114a1 Nomenclature History Previous Names. zgc:162266; Type … cristina rodriguez joWebCM000666 ( FASTA) Hromosom 4 je jedan od 23 para hromosoma u čovjeka. Ljudi obično imaju dvije kopije ovog hromosoma. Uključije više od 186 miliona parova baza (građevinski materijal DNK) i predstavlja između 6 i 6,5 procenata ukupne DNK u ćeliji . اسم غلا وش معناهWebJun 7, 2024 · This study found that a potentially novel MI- and CAD-associated gene, FAM114A1, plays an important role in pathological cardiac remodeling and fibrosis. … cristina rodriguez javier balboa parejaWebFeb 21, 2024 · Here, we found that a functionally unannotated human myocardial infarction (MI) associated gene, family with sequence similarity 114 member A1 (FAM114A1), is … اسم غرف شاتWebJul 8, 2024 · FAM114A1 is a critical autonomous factor for CF proliferation, activation, and migration. Mechanistically, FAM114A1 interacts with angiotensin receptor-associated … اسم غرف نوم